Uncanny genetic proportions from Hungary suggest a long lasting Hunter-Gatherer ancestry in Central Europe at the Bronze Age, Gerber et al.
Uncanny genetic proportions from Hungary suggest a long lasting Hunter-Gatherer ancestry in Central Europe at the Bronze Age
Gerber Dániel (1, 2), Ari Eszter (2, 3), Szeifert Bea (1, 2), Kustár Ágnes, Fábián Szilvia (4), Bondár Mária (5), Kiss Viktória (5), Köhler Kitti (5), Mende Balázs Gusztáv (1), Szécsényi-Nagy Anna (1)
1 - Research Centre for the Humanities, Institute of Archaeogenomics, Eötvös Loránd Research Network (ELKH), Budapest, Hungary (Hungary), 2 - Department of Genetics, ELTE Eötvös Loránd University, Budapest, Hungary (Hungary), 3 - Synthetic and Systems Biology Unit, Biological Research Centre, Eötvös Loránd Research Network (ELKH BRC) (Hungary), 4 - Natural History Museum (Hungary), 5 - Research Centre for the Humanities, Institute of Archaeology, Eötvös Loránd Research Network (ELKH), Budapest, Hungary (Hungary)
Bronze Age was a critical turning point in the formation of today's European populations when especially Central Europe became genetically really colourful. Recent large-scale studies tend to focus on the non-European connections and impacts of incoming populations, however, many factors that shaped the European genepool remains mostly uninvestigated. A number of neglected genetically outlier individuals left an anomalous proportion of Hunter-Gatherer (HG) heritage unrecognized in the post-Neolithic period. Rivollat et al. 2020 have already described elevated HG ancestry from Middle-Late Neolithic sites in present-day Germany, but without further uncovering its exact source and subsequent history. In our study communities of a single site, called Balatonkeresztúr in Western Hungary, from the Early-Middle Bronze age Kisapostag/Encrusted Pottery culture was genetically analysed for the first time, owing to their extensive cremation practices. The site provides further evidence of an increased, yet mosaically appearing HG component in Central Europe even at the Bronze Age, which likely originated in the region, as suggested by additional novel and published outlier samples. The hunt for the HG components' origin is presented in this talk, where yet barely used high coverage genomes were co-analysed and set to new directions by our dataset. We applied low coverage shotgun and genome-wide capture data of 20 individuals from the site, who belong to at least three distinct archaeological horizons. We were able to pinpoint rare genetic diseases, pigmentation, kinship, social organisation and population affinites of these people, thus providing the complex and multidisciplinary interpretation of these Bronze Age communities.
https://isba9.sciencesconf.org/data/pages/Abstract_Book_ISBA9_2022.pdf
https://twitter.com/GerberDniel2/status/1400010765445353475 |
Comments
That's why I think that it must have come from some unsampled population living in the Carpathian valleys, some kind of Neolithic Vlachs, HG who switched to mountain pastoralism and avoided being overran or assimilated by the EEF.
In this case not the level of WHG is important, but the kind of drift they have and the conclusion that they're of local origin.
https://slavicorigins.blogspot.com/2021/08/eaa-2021-abstracts.html
"The homogeneity of the male lineages of the Nitra culture’s population, the detected distinct ancestry components and the comparison of the male and female admixture signals"
https://www.nature.com/articles/s41598-021-94932-9
It's about the excess of WHG in Jagodnjak.
"Tollense shares its specific WHG ancestry (aka "Balto-Slavic drift") with Baltic_BA, Balto-Slavs, and many groups from the Balkans or Carpathians. From the samples we currently have: Mokrin, Kyjatice, Fuzesabony, Mako, Hungarian Bell Beaker, Hallstatt, La Tene, Vekerzug. All these groups are closely related to each other and are a part of a Carpathian metapopulation (Baltic_BA and Balto-Slavs included)."
"@ambron, yes, I agree that what Arza says there is plausible and I don't think any of this comes as a surprise to you. I thought it was interesting as there is often a suggestion that Global25 has created a false affinity between these WHG-rich samples and Baltic or Slavic peoples, but I haven't had a group of samples that's good enough before to test if this is the case in formal stats. And the formal stats to me seem to support the affinity being real and not false, and moreover that these samples aren't necessarily well explained by being between Latvia_BA and other populations, necessarily."
Thus, the Balto-Slavic drift is a real phenomenon, not an artifact of the adopted method. The Balto-Slavic drift is not an effect to the admixture of the Baltic BA. And that's the most important thing.
Re: Jagodnjak
In the presentation of A. Sz-N. there were also earlier (EBA) Croatian samples that were much more HG-rich than the ones from Jagodnjak. I expect that they'll also show "the Balto-Slavic drift", just like the MBA ones from Jagodnjak.
https://mobilitas.ri.abtk.hu/wp-content/uploads/EAA2022-Bp-768x432.jpg
https://mobilitas.ri.abtk.hu/?media=tagulo-horizontok-kutatocsoportunk-eloadasai-az-europai-regeszek-szovetsege-27-eves-konferenciajan&lang=hu
So it's highly likely that a lot of studies about Carpathians will be published around that time.
BTW There's a podcast with Daniel Gerber, but unfortunately it's in Hungarian without any transcription:
https://mobilitas.ri.abtk.hu/?media=a-mult-helyszineloi-regeszeti-es-archeogenetikai-kutatasokrol-a-glossza-uj-adasaban&lang=hu
https://soundcloud.com/user-225585157/a-mult-helyszineloi-beszelgetes-fabian-szilviaval-es-gerber-daniellel-1
Maciej Chyleński
The migration of Goths and its consequences was undoubtedly one of the most important events shaping Europe in the period of Roman influence. Therefore it is not surprising that they arouse unfailing interest of researchers and history enthusiasts. However, despite this interest, the combination of these known from the history of migration with any empirical data proves to be a difficult challenge. In the area of present-day Poland, the migration of Goths is most often associated with the archaeology of the Wielbark culture. The newcomers in Pomerania are especially associated with In particular, the relatively sudden appearance of elaborate stone constructions (such The newcomers are particularly associated with the relatively sudden appearance of elaborate stone constructions (such as stele circles or cobblestones) in cemeteries associated with this culture. However, some researchers believe that the native origin of the Wielbark culture should not However, some scholars believe that the native origin of the Wielbark culture should not be in doubt as there are numerous indications that it gradually developed However, some researchers believe that the native origin of the Wielbark culture should not be in doubt as there are numerous indications that it gradually developed in the first century AD from the preceding Oksywska culture. However, the same researchers admit that the sudden appearance of the above-mentioned stone structures, immediately various forms, can only be explained by some kind of migration from the lands of Scandinavia, where analogous structures were present in earlier periods. In our project we intend to use the latest techniques developed by geochemistry and genetics to investigate the emergence and spread of the Goths identified with the Wielbark culture. Almost all of the burials selected for our study selected for our study come from cemeteries of the Wielbark culture where stone constructions were present. The samples we have collected will be dissected using radiocarbon methods and subjected to genetic analyses. Moreover, all samples will be analysed in terms of isotopes of carbon and nitrogen in collagen and carbon, strontium and oxygen in dental enamel. Migrations Goths are about as ideal a phenomenon to use these methods as the geological background in Scandinavia differs significantly from that in northern Poland and the isotopic composition reflecting this background should differ significantly between potential arrivals and local communities.
https://projekty.ncn.gov.pl/index.php?projekt_id=502034
Amount granted: 768,128 PLN
Project commencement: 2021-10-01
Project completion: 2024-09-30
Planned project duration: 36 months (from proposal)
Project status: in progress
Anita Szczepanek
The aim of the project is to establish the role of women in Early Bronze Age communities (2300-1600 BC) on the basis of interdisciplinary analyses of materials of the mierzanowicka culture from southeastern Poland. The task will be carried out through a comprehensive study of a selected cemetery of the mierzanowicka culture (60 individuals), followed by analogous analyses of selected series of representatives of this culture from sites located in southeastern Poland (40 individuals). The interdisciplinary analyses will include archaeogenetic and isotopic studies, allowing for the establishment of absolute chronology, reconstruction of the diet of buried individuals, as well as their place of residence and possible migrations. The selected area, which is a gateway to Central Europe, has always been a terrain penetrated by various population groups, with various purposes - from plunder to settlement. Today, modern research methods make it possible to follow these migration routes and to capture changes in local communities previously recorded by the emergence of new cultural elements, ranging from monuments to settlement and belief changes reflected in funerary rituals. The aim of the project is to verify a number of hypotheses concerning the role of women in Early Bronze Age communities against the background of male representatives: - women show greater genetic variation in both mtDNA, as well as nuclear - verification through aDNA analyses - women are more mobile - verification through strontium isotope analyses - women show greater morphological differentiation - verification through anthropological analyses - women's and men's diets differ and the diet of the women's group is differentiated and depends on the social status - verification through stable carbon and nitrogen isotope analyses - the position of women in the local community is reflected in the grave furnishings - verification through archaeological analysis taking into account the results of microscopic examination of pottery, traseological analyses of flint tools and neodymium isotope determinations in faience beads indicating their origin). The recording of female/male differences using interdisciplinary research will thus be confronted with the results of archaeological analyses. The comprehensive results will provide new data from materials collected during many years of research conducted in the 20th century. The results of the research will be published in a monograph on the necropolis of the people of the Mierzanowice culture in Krzyżanowice Dolne and a series of articles with an international range, as well as presented at local and international conferences The anthropological analysis will be carried out in accordance with classical research methodology supplemented with odontological and palaeopathological analyses and morphological analyses of the bones which allow establishing the degree of development of muscle attachments. Interdisciplinary analyses will include radiocarbon dating, aDNA and isotopic studies that will allow for the reconstruction of genetic structure, paleodiversity (stable isotopes of carbon and nitrogen) and individual mobility of individuals (strontium isotopes), as well as the origin of faience beads (neodymium isotope analyses). The interdisciplinary analyses will be carried out in the centers with which we have collaborated during previous projects. Results of specialist research will be confronted with analyses of archaeological artefacts furnishing the graves of the analysed people. Simultaneously, microscopic analysis of ceramics and traseological analysis of flint tools will be carried out. The traseology of the flint artefacts will allow us to grasp the possible relationships: artefact-act-morphology of the skeleton- paleo diet.
https://projekty.ncn.gov.pl/index.php?projekt_id=497704
Amount granted: 1,292,923 PLN
Project start: 2021-06-02
Project completion: 2025-06-01
Planned project duration: 48 months (from proposal)
Project status: in progress
I13795 - https://www.yfull.com/tree/R-Z280/ (xZ92,CTS1211)
I14193 - https://www.yfull.com/tree/R-Z280/ (xCTS1211)
I18719 - https://www.yfull.com/tree/I-CTS10228/
I25524 - https://www.yfull.com/tree/R-M458/
From:
Large-Scale Migration into Southern Britain During the Middle to Late Bronze Age
https://www.ebi.ac.uk/ena/browser/view/PRJEB47891?show=reads
A new study of whole genome ancient DNA from Bronze and Iron Age populations, focusing on Britain but including substantial new datasets for areas of continental Europe, has also identified major genetic changes in the Middle-Late Bronze Age (c. 1300‒800 BCE). In Britain specifically, a rise in ancestry derived from Early European Farmers (EEF) appears to represent an influx of people from a region most likely located in present-day France. Due to a paucity of aDNA coverage in the potential source region(s), it is presently impossible to determine whether the movement of people was reciprocal or unidirectional. It is striking, however, that many of those who moved appear to have been female. Similar genetic changes are evident in the Netherlands and Czechia, although based on fewer samples, while in Iberia we see a decrease in EEF ancestry.
Both Z280 are from the Bronze Age.
Tell Waldemar that most if not all of the samples he listed are females:
"I11034: R-YP561
I11708: R-YP561
I11993: R-YP561
I12790: R-YP561
I13791: R-YP561
I14980: R-YP561
I15049: R-YP561
I16430: R-YP561"
Yes, they're from several countries from Central and Western Europe.
I13780 - https://www.yfull.com/tree/R-YP5267/
is mixed Slavic - Germanic/Celtic
I13795 - https://www.yfull.com/tree/R-Z280/ (xZ92,CTS1211)
is French-like
I14193 - https://www.yfull.com/tree/R-Z280/ (xCTS1211)
is Sintashta-like
I18719 - https://www.yfull.com/tree/I-CTS10228/
is Bulgarian-like
I25524 - https://www.yfull.com/tree/R-M458/
is Lithuanian-like
is mixed Slavic - Germanic/Celtic
So just like the MX265.
I25524 - https://www.yfull.com/tree/R-M458/
is Lithuanian-like
This may be interesting because, as far as I know, there are no Pribaltika samples in this collection. This could be another Czech (or nearby) Baltic BA after VLI051.
I'm not sure if they'll look the same in G25, but in a PCA that I have there are multiple female and some male samples with "non-Slavic" hgs that look like modern day Slavs.
https://i.postimg.cc/hK5WkJjf/LBAIA-unknown.png
Few notes:
- in G25 some samples may appear to be less Balto-Slavic as the PCA above seems to be better at picking up the "Balto-Slavic-drift" (potentially exaggerating it),
- I20515 seems to be WHG-rich (think Tollense) and not Russian-like.
Hard to say whether this read is correct or not, but there's nothing suspicious in the bam file:
chry 23495214 YP5269 R1a1a1b1a1a1c1a3a~ G->A G A 1 100 A D
23207:13567:13556 0 Y 23495182 37 40M * 0 0 CAATGGTCCAGAGCTTGTAACCCAGCACTTTCAGGTGTAA EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE X0:i:1 X1:i:0 MD:Z:32G7 XD:Z:GACTGTA_GCTACAT_40 RG:Z:Hupyrian_1240k_plus_half_S13780.Y1.E1.L1_20181105_HN2JLBGX7_1 XG:i:0 NM:i:1 XM:i:1 XO:i:0 XT:A:U
Mapping and base quality are both high. Additionally the filename reveals that Harvard has finally found the elusive Slavic homeland:
"The Hupyrians were a humanoid species native to either the Alpha or Beta Quadrant. They had tight skin with a slightly scowling expression."
It also explains how Slavs have appeared so suddenly and unexpectedly - they've used teleports and cloaking devices.
PS The sample is at least 3 years old - "20181105".
Besides that 2 nodes between YP5267 and L1029 have just a single mutation. YFull estimates the time between the formation of YP5267 and the TMRCA of L1029 to be 400 years, but in reality it could've had happened in 40 years.
Is it possible to compare the I13780 sample to the LIB11 sample you covered here:
https://slavicorigins.blogspot.com/2021/05/surplus-eef-ancestry-in-modern-day-slavs.html?m=1
They're different. LIB11 has a genetic profile of an early Slavic population that've moved South and gave rise to the South Slavs. I13780 looks like a Celt with a Slavic, Russian-like grandparent.
Hard to say more without an official data release (properly processed data, dating, other samples from the same area etc.).
Some time ago I proposed following model for Slavic expansion and diversity:
https://postimg.cc/64y9tHdK
Arza fund following Slavic Y-DNA in Celtic papier data:
I13780 - https://www.yfull.com/tree/R-YP5267/
is mixed Slavic - Germanic/Celtic
I13795 - https://www.yfull.com/tree/R-Z280/ (xZ92,CTS1211)
is French-like
I14193 - https://www.yfull.com/tree/R-Z280/ (xCTS1211)
is Sintashta-like
I18719 - https://www.yfull.com/tree/I-CTS10228/
is Bulgarian-like
I25524 - https://www.yfull.com/tree/R-M458/
is Lithuanian-like
I have added new G25 data with Slavic Y-DNA:
https://postimg.cc/tn10zh5C
It seems to confirm my model. The diversity of early Slavs was probably even greater as they mixed with adjacent populations:
Linguistically and culturally Sintashta was very close to early Slavs as links with Mierzanowice, Unetice and Trzciniec show.
Target: Celtic_paper:I13780
Distance: 1.1832% / 0.01183218 | R3P
38.2 Danish
32.0 Russian_Tver
29.8 Dutch
According to the abstract from A. Szecsenyi-Nagy in Nitra we should expect some outliers, especially among the females. I wouldn't be surprised if Nitra fell 1:1 into that shape.
What rumours?
Apparently there's a plenty of new data from the neolithic up to medieval times.